HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to Personal Folders Download to citation manager Permission Requests Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hirsch, G. M. Articles by Lee, T. Search for Related Content PubMed PubMed Citation Articles by Hirsch, G. M. Articles by Lee, T.

Eur J Cardiothorac Surg 1998;14:89-97
© 1998 Elsevier Science NL

Medial smooth muscle cell loss in arterial allografts occurs by cytolytic cell induced apoptosis¹

^a Department of Surgery, Division of Cardiovascular Surgery, Dalhousie University School of Medicine, Halifax, Nova Scotia, Canada
^b Department of Allergy and Immunology, Dalhousie University School of Medicine, Halifax, Nova Scotia, Canada
^c Department of Pathology, Harvard Medical School, Boston, MA, USA

Received 29 September 1997; received in revised form 17 February 1998; accepted 15 April 1998.

Corresponding author. QE II Health Sciences Centre, 1796 Summer Street, Room 2271, Halifax, Nova Scotia Canada B3H 3A7. Tel.: +1 902 4737890/2356; fax: +1 902 4734448; e-mail: ghirsch@is.dal.ca

	Abstract

Top Abstract Introduction Methods Results Discussion Appendix A. Conference... References

 
Objective: Experimental arterial allografts, used as models of chronic rejection, undergo marked loss of smooth muscle cells (SMC) from their media prior to the development of occlusive, intimal proliferative lesions. Medial SMC loss has been described in human heart transplants, and may be related to the development of occlusive coronary lesions which are the hallmark of chronic rejection. This SMC loss does not exhibit the characteristics of necrotic cell death. We sought to determine whether medial SMC loss in arterial allografts occurs by apoptosis. We further investigated these allografts for cytolytic cell-derived inducers of apoptosis, Finally, we compared two different strain combinations to assess the impact of varying histoincompatability on medial SMC loss. Methods: Evidence for internucleosomal DNA degradation, which is characteristic of apoptosis, was sought by the in situ terminal deoxynucleotidyl transferase nick end labelling (TUNEL) method carried out on Lewis to Fisher rat femoral artery transplants (disparate at minor loci only) and Brown Norway to Lewis aortic transplants (fully disparate at major and minor loci). Isografts (Lewis to Lewis) served as controls. In a separate series of experiments graft mRNA was extracted and analysed by reverse transcription-polymerase chain reaction (RT-PCR) with primers for molecular inducers of apoptosis (TNF-, Fas ligand, perforin, and granzyme-B) which are derived from cytolytic cells known to be present in allografts. Results: Allograft media contained large numbers of TUNEL stained nuclei in both strain combinations. Neither isografts nor ungrafted femoral artery segments stained positive for apoptosis. RT-PCR on whole allografts in both strain combinations revealed sustained upregulation of perforin, granzyme-B, Fas-ligand and TNF- mRNA concomitant with medial SMC loss. Autografts demonstrated sustained up regulation of TNF-, and perforin, but only brief upregulation of granzyme-B, and no upregulation of Fas-ligand. Conclusions: These data strongly suggest that medial SMC loss in allograft arteriopathy occurs by apoptosis. Further, RT-PCR data indicate that cytolytic cell-derived inducers of apoptosis are upregulated in these grafts and may be accountable for medial SMC apoptotic cell death. Finally, fully-disparate (Brown Norway to Lewis) and minor-only incompatible (Lewis to Fisher) strain combinations both resulted in marked intimal proliferation, medial SMC loss by apoptosis, and similar patterns of expression of cytolytic cell derived inducers of apoptosis. Insofar as intimal proliferative lesion-formation may be dependent on medial damage (as in arterial-injury models), understanding the mechanism of medial SMC loss may provide a novel therapeutic approach to human cardiac transplant arteriopathy.

Key Words: Allograft • Artery • Chronic rejection • Apoptosis • TNF- • Perforin • Granzyme-B • Fas-ligand

	Introduction

Top Abstract Introduction Methods Results Discussion Appendix A. Conference... References

 
Experimental arterial allografts, in which arterial segments are transplanted between inbred rat strains, develop diffuse, concentric intimal proliferative lesions analogous to those seen in chronic rejection of vascularised organs. This model demonstrates marked loss of medial smooth muscle cells (SMC) concomitant with the development of myo-intimal proliferative lesions [1] [2].Medial smooth muscle cell loss has been described in both experimental heterotopic heart transplants and in human cardiac transplantation [3] [4]. Given that SMC loss from allograft media is temporally linked to the development of intimal proliferative lesions we believe it may be important to understanding the pathogenesis of allograft arteriopathy. This would be analogous to vascular responses to arterial injury, where intimal proliferation is dependent upon, and proportional to, the degree of medial injury inflicted [5]. In examination of our own arterial allografts we observed occasional apoptotic bodies within the media at early time points (4–14 days). Furthermore, medial smooth muscle cell dropout occurred in the absence of a medial inflammatory infiltrate, thus inconsistent with typical necrotic smooth muscle cell death. We hypothesised that medial smooth muscle cell loss was occurring by apoptosis.

Both macrophages and cytotoxic T-lymphocytes (CTL) can induce apoptotic cell death in neighbouring cells, and both are present in arterial allografts concomitant with medial SMC loss [6]. Macrophages, via interaction of membrane bound TNF-alpha with the TNF receptor family on target cells, can precipitate apoptosis [7]. CTL can trigger apoptotic cell death via Fas–Fas ligand interactions in Fas-ligand-expressing tissues [8]. CTL can also employ perforin (a membrane pore-forming protein) to introduce cytotoxic granules containing granzyme B. Granzyme B subsequently cleaves and thus activates endogenous proteases (CPP-32) resulting in triggering of the cell death pathway [9].

Our goal was to determine whether medial smooth muscle cell loss was occurring by an apoptotic mechanism. This was accomplished utilising in situ terminal deoxynucleotidyl transferase (TUNEL) technique with digoxigenin-labelled nucleotide to label the 3' ends of fragmented DNA. Subsequently, we investigated grafts with RT-PCR for the presence of known CTL and macrophage-derived inducers of apoptosis, namely: Fas-ligand, TNF-alpha, perforin and granzyme B. Finally we compared these results between two strain combinations – Lewis to Fisher (minor-incompatible only) and Brown Norway to Lewis (fully disparate at minor and major loci).

	Methods

Top Abstract Introduction Methods Results Discussion Appendix A. Conference... References

 
Surgical Model
Inbred rat strains (LewisFisher), (Brown Norway to Lewis) are utilised. Femoral arterial segments (Lewis to Fisher) or aortic segments (Brown Norway to Lewis) were harvested from donors and implanted into divided recipient arteries (femoral or aortic respectively) utilising end-to-end, microsurgical anastomotic technique. Isografts (Lewis to self) were utilised as controls. There was essentially no morbidity or mortality. In the LewisFisher femoral-arterial transplant model, an initial time-course for descriptive histology and TUNEL analysis was carried out with two allografts and one autograft each at days 1, 2, 4, 7, 10, 14, 30 and 60. After analysis of these data, more grafts were performed at days 2, 4, 7, 14 and 30, both for further histology and TUNEL analysis and for RNA extraction for reverse transcriptase polymerase chain reaction (RT-PCR). There were at least four allografts and two autografts at each of these time points. A total of 48 femoral grafts were performed including 33 allografts and 13 autograft controls. In the Brown Norway to Lewis aortic interposition model we performed six allografts and six autografts each at days 4, 8, 14 and 20 for a total of 48 grafts including 24 allografts and 24 controls. Grafts were harvested and immersion-fixed (4 g/100 ml paraformaldehyde, 0.05% v./v. glutaraldehyde, 15% v./v. saturated picric acid) at 4°C for 4 h. Grafts were then paraffin-embedded and 5-mm sections were cut for routine histology (H & E, Verhoeff elastin) and for immunocytochemical and TdT nick-end labelling studies. Autografts (Lewis to Lewis) were carried out at 4 and 14 days. For RT-PCR, portions of grafts were harvested and snap-frozen directly in liquid nitrogen. Total RNA was subsequently extracted as described below.

Immunocytochemistry
Immunocytochemistry with monoclonal antibodies was carried out to define cellular populations in allografts during progression of medial smooth muscle cell loss and intimal proliferation. Slides were deparaffinised; endogenous peroxidase was quenched (0.6% HOOH/MeOH); non-specific staining blocked with normal horse serum; and subsequently incubated with primary antibody (1 h,37°C). Monoclonal antibody HHF-35 (alpha actin) at 1:1000 was used to identify muscle cells and ED-1 at 1:200 was used to identify rat monocyte/macrophages. Sections were then incubated with biotinylated secondary antibody and finally labelled with peroxidase avidin/biotin complex utilising 3,3' diaminobenzidine as the chromogen (Vector, Burlingame, CA).

In-situ detection of apoptosis (TUNEL)
A commercial assay (ApopTag In Situ Apoptosis Detection Kit)^TM (Oncor, Gaithersberg, MD) utilising terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end labelling (TUNEL) was used to detect nuclear DNA fragmentation indicative of apoptosis. Tissues were fixed and embedded in paraffin as described for histology and 5-mm sections were collected onto silinated glass microscope slides. Sections were deparaffinised through graded alcohol into 0.1 M PBS. Tissue sections were covered with 100 µg/ml RNase A (Boehringer Mannheim, Laval, Quebec) in 2x SSC buffer and incubated in a humidified chamber for 40 min at 37°C. Slides were washed three times in 2x SSC buffer. Endogenous peroxidase was quenched in fresh 0.15% hydrogen peroxide in 0.1 M PBS for 25 min at room temperature, rinsed in 0.1 M PBS, and covered with pre-warmed 37°C proteinase K (Boehringer Mannheim) (20 µg/ml in TE buffer, pH 8.0). Slides were incubated at 37°C for 1 min and then on ice in chilled 2 mg/ml glycine in 0.1 M PBS for 15 min. Following 10 min in -20°C ethanol:acetic acid (2:1), slides were rinsed with 2x SSC buffer and sections were covered with equilibration buffer (ApopTag^TM Kit) for 10 min. Sections were treated with TdT enzyme with digoxigenin-labelled dUTP (ApopTag^TM Kit), as suggested by the supplier, in a humidified chamber at 37°C for 2 h. The reaction was stopped by three 10-min washes in 37°C 2x SSC buffer. The sections were covered with peroxidase-labelled anti-digoxygenin antibody with 0.1% Tween 20 for 1 h at 37^°C in a humidified chamber. Slides were washed in 0.1 M PBS. Colour development was achieved by exposing sections to freshly-prepared 0.01% hydrogen peroxide utilising 0.6 mg/ml 3,3' diaminobenzidine as the chromogen, for up to 20 min at room temperature. Sections were counterstained with methyl green, dehydrated, and mounted. Normal rat intestine was utilised as a positive control tissue. For negative controls, distilled water was substituted for the TdT enzyme.

Reverse transcription-polymerase chain reaction (RT-PCR)
Rat arterial allografts were harvested after induction of anaesthesia with i.p. pentobarbitol. Total cellular RNA was extracted from tissue samples (either fresh, or after snap-freezing in liquid nitrogen and storage at -70°C) using TRIZOL^TM Reagent (Life Technologies, Burlington, ON) as instructed by the manufacturer. mRNA levels for mediators of apoptosis were measured using RT-PCR. One microgram of extracted RNA was reverse transcribed in a 20-ml reaction mixture containing 1x first strand buffer (Life Technologies) 0.01 M DTT (Life Technologies), 0.5 mM dNTPs (Pharmacia Biotech, Baie d'Urfe, Qeubec), 1 µg random hexamers (Pharmacia Biotech), and 200 units of murine Moloney Leukemia Virus reverse transcriptase (Life Technologies). After the mixture was allowed to sit at room temperature for 10 min, the reaction was performed at 37°C for 1 h. cDNA samples were the heated to 94°C for 10 min. The same first-strand cDNA sample was used in the analyses for ß-actin, perforin/cytolysis, granzyme B, fas ligand, and tumour necrosis factor (TNF-).

Using an algorithm designed by Lowe et al. the published gene or cDNA sequences were used to identify oligodeoxyribonucleotide sequences suitable for use as primers in PCR for ß-actin, perforin/cytolysis, granzyme B, fas-ligand, and TNF-. Primers for the control transcript ß-actin were designed to amplify products from the gene and cDNA of similar but unequal size to allow for the detection of contaminating genomic DNA in the RNA preparations. All primer pairs (synthesised by OligoExpress ^TM, BioCan Scientific, Mississauga, ON) amplify products of the predicted size based on the published gene or cDNA sequence. Primer sequences (written 5'3') and predicted product sizes are as follows:

ß-actin: 5' (sense) CTGGAGAAGAGCTATGAGC

3'(antisense) AGGATAGAGCCACCAATCC

cDNA product size 330 bp; genomic product size 542 bp

perforin/cytolysis: 5' (sense) TATCAATAACGACTGGCGTGC

3'(antisense) TAGGAAGAGATGAGTCTACGG

cDNA product size 285 bp

granzyme B: 5' (sense) AAGATGAAGCTCCTCTTGCTCC

3'(antisense) CACCACAGGGATGATTTGTTGC

cDNA product size 282 bp

fas-ligand: 5' (sense) TTTCTTGTCCATCCFTCTGG

3'(antisense) TGTGGTTGGTGAACTCACG

cDNA product size 264 bp

TNF-: 5' (sense) TACTGAACTTCGGGGTGATCG

3'_(antisense) CCTTGTCCCFTTGAAGAGAACC

cDNA product size 292 bp

For PCR, 4 µl or 2 µl of the cDNA generated in the RT reaction were used as a template for perforin/cytolysin, granzyme B, fas-ligand, and TNF-, or for ß-actin, respectively. The PCR reaction mixture (50 µl final volume) consisted of the following reagents in final concentration: 1x reaction buffer (50 mM Kcl, 20 mM Tris–HCl, pH 8.40, 2.5 mM MgCl, 0.1 µg/ml bovine serum albumin), 0.2 mM dNTPs, 2.5 pM each of 5' and 3' oligdeoxyribonucleotide, and 2.5 units of Taq DNA polymerase (Life Technologies). Samples with no added template were used as negative controls; RNA samples known to contain the mRNAs of interest were used as positive controls. PCR was performed in a Temp Tronic automated thermocycler (Thermolyne, Dubuque, IA) programmed for 40 cycles, cycling between 92°C for 1 min, 60°C for 30 s and 72°C for 30 s, followed by a final 5-min incubation at 72°C. One µg of 100 base-pair ladder (Life Technologies) or 16 ml of the PCR products were electrophoresed through a 1.5% agarose gel containing 0.5 µg/ml ethidium bromide. Polaroid photographs of the stained products were taken under UV exposure.

	Results

Top Abstract Introduction Methods Results Discussion Appendix A. Conference... References

 
Histology and immunohistochemistry
Due to the novelty of the Lewis to Fisher femoral artery allograft model, routine histology and immunohistochemistry were carried out to define the cellular populations in allografts during progression of medial SMC loss and intimal proliferation. Our histological findings echo those of Pekka Hayry and Gordon [1] [2]. There is an early inflammatory infiltrate in the intima and adventitia, followed by striking medial smooth muscle cell loss and the development of intimal occlusive lesions made up initially of a mix of monocytes/macrophages and actin-positive cells presumed to be smooth muscle cells and ultimately comprised of pure populations of such actin-positive cells. We noted that the media undergoes smooth muscle cell loss to the point of becoming almost acellular ( Fig. 1 ). The medial smooth muscle cell loss occurs largely in the absence of inflammatory cell infiltrate in the media. Cell shrinkage with occasional apoptotic bodies were identified in the media. Autografts (Lewis to Lewis) undergo an early inflammatory infiltrate but were not subject to either sustained intimal proliferative lesion formation or medial smooth muscle cell loss ( Fig. 2 ). Immunostaining with HHF-35 revealed that the cells composing the neointima at late time points (30 days) were almost exclusively alpha-actin positive SMC ( Fig. 3 ). At early time-points, SMC staining was confined to the media. Over time, however, allografts demonstrated a loss of SMC in the media, and an accumulation of SMC in the growing neointima. Staining with ED-1 demonstrated an early macrophage infiltrate, with macrophages detectable in the intima, media and adventitia of the rejecting allografts as early as day 7 (the earliest time-point tested). This infiltrate became increasingly heavy up to day 30, when infiltration appeared to decline until day 100, at which point staining was sparse. T-cells were also detected, in all three vascular compartments, with infiltration patterns roughly parallel to macrophages. There was clear evidence of T-cells in the media (data not shown).

View larger version (101K): [in this window] [in a new window]   Fig. 1. Lewis to self control arterial autograft 60 days post implantation. Note the normal-appearing media (M) populated by SMC (H & E, x250).

View larger version (117K): [in this window] [in a new window]   Fig. 2. Lewis to Fisher arterial allograft 60 days post transplantation. Note the shrunken, acellular media (M), and the pronounced intimal proliferative lesion (I) (H & E, x250).

View larger version (122K): [in this window] [in a new window]   Fig. 3. Lewis to Fisher arterial allograft 60 days post transplantation stained for smooth muscle cells (SMC) by monoclonal immunocytochemistry with moAb HHF-35 (alpha actin). Note the absence of SMC staining in the media and the marked staining of the intimal proliferative cell mass indicating that the majority of intimal proliferative cells are SMC (x100).

View larger version (110K): [in this window] [in a new window]   Fig. 4. TUNEL-stained Lewis to Fisher arterial allograft 2 days post-transplantation. Note the TUNEL-positive medial cells demonstrating nuclear-associated staining (x250).

View larger version (38K): [in this window] [in a new window]   Fig. 5. Mean apoptotic cell counts per medial cross-section. Sections of Lewis to Fisher (A), and Brown Norway to Lewis arterial allografts (B), were TUNEL-stained and scored by counting TUNEL-positive nuclei in the medial compartment. Lewis to self controls were similarly scored. The observer was blinded to the strain combination employed. Data is expressed as the mean number of positive cells per section.

View larger version (131K): [in this window] [in a new window]   Fig. 6. TUNEL-stained Lewis jejunum. Note the positive nuclei towards the apex of the villi. Jejunal sections were included in all TUNEL-staining batches as a positive control.

RT-PCR analysis revealed that perforin and granzyme B, which constitute a calcium-dependent, CTL killing pathway are expressed at all time points in allografts of both Brown Norway to Lewis and Lewis to Fisher transplants. Fas-ligand, which mediates a calcium-independent, CTL-mediated killing pathway was expressed in Brown Norway to Lewis grafts by day 8 and in Lewis to Fisher grafts by day 10. Finally, the macrophage cytokine, TNF-, was expressed at all time-points in both allograft strain combinations. Both perforin and TNF- were also expressed in autografts, perhaps accountable to the mild T-cell and macrophage infiltration seen in these grafts. In contrast, however, granzyme B expression was only detected during a brief time period (days 8–10) in autografts, and Fas-ligand was never detected in autografts ( Fig. 7 and Fig. 8 ).

View larger version (14K): [in this window] [in a new window]   Fig. 7. Expression of molecular inducers of apoptosis in Brown Norway to Lewis aortic allografts, Lewis to Fisher femoral allografts and Lewis to self control autografts. RT-PCR was performed on whole-graft RNA extracts as described using primers for perforin, granzyme-B, Fas-ligand, TNF-_and ß-actin as a positive control. (A) Day 4 Brown Norway to Lewis (allo) and Lewis to Lewis (auto). (B) Day 14 Brown Norway to Lewis (allo) and Lewis to Lewis (auto). (C) Days 6 and 14 Lewis to Fisher (allo) and Lewis to Lewis (auto).

View larger version (54K): [in this window] [in a new window]   Fig. 8. Composite results of RT-PCR for apoptotic inducer molecules on RNA from Lewis to Fisher femoral artery (A) and Brown Norway to Lewis aortic interposition grafts (B). + indicates the presence of a band and - indicates the absence of a band after RT-PCR amplification.

	Discussion

Top Abstract Introduction Methods Results Discussion Appendix A. Conference... References

Arterial allografts are subject to a striking loss of medial SMC concomitant with the development of intimal proliferative lesions. We suggest that this medial SMC loss is a central event in the development of the intimal proliferative lesion of chronic rejection. We propose that the intimal proliferative response seen in chronic rejection is an attempt to repair the immune-mediated medial SMC damage. This is analogous to the balloon-injury model of arteriosclerosis where it has been convincingly shown that medial damage is necessary for, and directly correlated to, the degree of subsequent intimal proliferation [5]. In balloon-injury models, however, the proliferative response is transient, abating when the media is healed. In the allograft-artery model, however, SMC repopulation of the media never occurs ( Fig. 1) and an unrestrained repair response proceeds in the intima [2]. Interestingly, in a recent study Perlman et al. have documented that medial smooth muscle cell death in a balloon arterial injury model occurs by apoptosis [11].

We sought initially to determine the mechanism of this medial SMC loss. While this medial SMC loss is termed medial necrosis by some investigators, it occurs in the absence of a medial inflammatory response. As such, this medial SMC loss is not consistent with classical necrosis [12]. Gordon et al. claim that medial SMC loss represents mere migration of SMC from the media into the intimal compartment [1]. While migration of SMC from media to intima has been put forward as a mechanism for the intimal proliferative lesion formation seen in arterial injury (e.g. carotid balloon-catheter or air-injury models) none of these models demonstrates significant depopulation of the media, as seen in arterial allografts [13]. Thus, mere migration of smooth muscle cells from media to intimal on a scale sufficient to depopulate the media seems unlikely.

Our data indicate that medial smooth muscle cell loss is mediated through apoptosis. TUNEL-positive cells in the media occur in the absence of inflammation, and as such the likelihood is that smooth muscle cells are the TUNEL-positive cells (rather than leukocytes). In contrast, adventitial TUNEL-positive cells in our samples may well be infiltrating leukocytes, as these are plentiful in allograft adventitia. Bergese et al. demonstrated apoptosis in the perivascular adventitia in a murine heterotopic heart transplant model [14]. In their study, concomitant immunocytochemistry demonstrated that the apoptotic cells were indeed leukocytes. Krams et al. demonstrated hepatocyte apoptosis in a rat model of liver transplantation [15]. In this study, apoptosis was restricted to hepatocytes undergoing acute rejection. In contrast to these studies of apoptosis in experimental transplant models of acute rejection, we have documented for the first time evidence of apoptotic cell death in a chronic rejection model which results in allograft arteriopathy.

In our study as many as 20 apoptotic cells were identified in the media per cross section. This is an apoptotic index of about 10%, given an average of 200 medial smooth muscle cell nuclei per cross-section in rat femoral arteries. Considering the brief window (hours) in which cells undergoing apoptosis are identifiable by the TUNEL technique, this is a high index, and indicates that smooth muscle cell loss from allograft media is entirely mediated by apoptosis.

We further demonstrate that mRNA coding for molecular inducers of apoptosis are present in grafts at the time of medial smooth muscle cell loss by apoptosis. Whole allograft RT-PCR reveals the expression of mRNA for the known effectors of cytotoxic T-cell and macrophage mediated apoptosis, concomitant with observed medial SMC apoptosis. Both allografts and autografts demonstrated significant expression of mRNA for TNF-. The presence of TNF- in autografts may be attributable to macrophages present in the adventitia of these grafts as part of the inflammatory response to mechanical and ischaemic injury. While capable of inducing a wide variety of cellular responses, TNF- interaction with its low molecular weight receptor (p55) mediates apoptosis [16]. Apoptosis can be induced in vitro by both soluble and membrane bound TNF-. TNF- receptor binding results in cleavage of interleukin 1ß converting enzyme (ICE) with its subsequent activation and induction of target cell apoptosis [17]. Both CTL and macrophages can induce apoptosis via TNF- mediated pathways [15].

Killing by CD8-positive CTL is mediated by a number of pathways but one of the major CTL-killing mechanisms is mediated by direct contact between CTL and target cells. This is followed by exocytosis of granzymes (serine proteases) whose entry into the target cell is facilitated by the membranolytic activity of perforin [18]. Granzyme B cleaves the apoptotic protease CPP32 inducing apoptosis in target cells [19]. While perforin was expressed in both autografts and allografts, there was striking, sustained granzyme B mRNA expression only in allografts of both strain combinations used. Some granzyme B expression was recorded at early time-points in the Lewis autografts but that expression was not sustained.

An alternative pathway of CTL-mediated killing involves Fas–Fas ligand interaction where Fas protein expression on the target cell membrane binds to Fas-ligand on the effector CTL. Fas–Fas ligand interaction is followed by subsequent cross-linking of receptor and cleavage of target cell cytoplasmic CPP32 with resultant induction of apoptosis. CD8-positive CTL are not the only effector T cells to utilise the Fas–Fas ligand killing pathway. While CD4+CTL clones express perforin and granzyme, as well as Fas ligand, the kinetics of killing in these clones, and the inability of perforin anti sense oligonucleotides to inhibit CD4+ killing, indicates that CD4+CTL kill largely by Fas–Fas ligand interaction [20]. Fas-ligand mRNA was only expressed in allografts (days 8 and 14 Brown Norway to Lewis and day 14 Lewis to Fisher) and absent from autografts.

The use of an arterial allograft model allows the comparison of a fully-disparate strain combination (Brown Norway to Lewis) with a combination disparate only at minor loci (Lewis to Fisher), without the use of immunosuppressives. Both models result in total medial SMC loss and marked myo-intimal proliferative lesion formation. The medial SMC loss occurs by apoptosis in both models. The tempo of apoptotic cell loss is slower in the fully-disparate model. The pattern of mRNA expression of cytolytic cell-derived inducers of apoptosis is essentially the same in both models. Thus, varying the degree of histoincompatability between minor only and fully disparate strain combinations has little impact on either the degree, or the apparent mechanism of medial SMC loss in these allografts, nor on the ultimate development of intimal proliferative lesions characteristic of chronic rejection.

Taken together our data indicate that the medial SMC loss is mediated by apoptosis, and RT-PCR data indicate the presence of a variety of cytolytic cell derived apoptotic inducers. We suggest that medial SMC loss is occurring by cytolytic cell mediated apoptosis in an allo-specific manner. Finally, varying the degree of histoincompatability has little impact on the these events. Understanding the mechanism of medial damage in allograft arteriopathy may lead to novel, effective pharmacological interventions.

	Acknowledgments

 
Thanks to Dr. Andrew W. Stadnyk for primer design and Dr. Nadine Tatton for TUNEL.

	Footnotes

 
Presented at the 11th Annual Meeting of the European Association for Cardio-thoracic Surgery, Copenhagen, Denmark, September 28 – October 1, 1997.

	Appendix A. Conference discussion

Top Abstract Introduction Methods Results Discussion Appendix A. Conference... References

 
Dr N. Mendler (Munich, Germany): This is a very fascinating study, because once you get to the point where you can interfere with this, then you really would have a solution to one of the most severe problems we are faced with in transplantation.

Dr H. Aebert (Regensburg, Germany): I have two questions. First, how were the transplants treated before transplantation? Since you also found apoptotic cells in your autografts, apoptosis may be in part due to ischaemia and reperfusion injury as described by us and other groups. The second question is in which other cell layers did you find apoptosis, and, particularly, did you have a look at the vasa vasorum? If they are damaged or if their endothelial cells die following transplantation, this may have severe consequences for the survival of cells in the vascular wall of the grafts.

Dr Hirsch: They were treated fairly simply. They were flushed with heparin-containing solution and sewn in and then we didn't reperfuse until 45 minutes so that we wouldn't have a variation in the ischaemic reperfusion time. So there was a 45-minute period of ischaemia and then reflow. There is apoptotic activity in other levels, in the adventitia particularly, and it gets to be a little bit dicey calling the apoptosis apoptosis of a particular cell type there because there is quite an infiltration of leukocytes and it may be leukocyte apoptosis that we are observing. The way to get at that is, I think, double-staining with an immunocytochemical identification technique, although that is fairly fussy in my experience. The tissues fall off the slides by then because of all of the proteolytic digestion steps up front for the apoptosis assay. In regard to vasa vasorum, I think that events occurring in the vasa are fascinating and probably very important, although, frankly, I didn't focus here on the occurrence of apoptosis in the vasa per se. I imagine that there is enough adventitial apoptosis that there is apoptotic activity in the vasa as well.

Dr S.P. Hoerstrup (Zurich, Switzerland): If I understand it correctly and according to your abstract, your peak of apoptosis is on the fifth day. From our first experimental experience with lung transplantation in the rat model we have seen that there are in fact two peaks of apoptosis, one very early peak, within hours and a more delayed one. So have you had a look at such an early peak?

Dr G.M. Hirsch: Our data is now a little bit more complete than what is in our abstract. In the Lewis to Fisher model, which is a minor histocompatibility-mismatched model, there was a suggestion of a bimodal distribution of apoptotic activity over time, although the differences in apoptotic index between these peaks and valleys was not significant. In the fully-disparate model it's a somewhat later onset, not really significant until about day 7 or day 8, and then sustained to days 14 and 20.

	References

Top Abstract Introduction Methods Results Discussion Appendix A. Conference... References

 

1. Isik F.F., McDonald T.O., Ferguson M., Yamanaka E., Gordan D. Transplant arteriosclerosis in a rat aortic model. Am J Pathol 1992;141:1139-1149.[Abstract]
2. Menander A., Tilsala S., Paavonen T., Halttunen J., Hayry P. Chronic rejection of rat aortic allografts. An experimental model for transplant arteriosclerosis. Arterioscler Thromb 1991;11(3):671-680.[Abstract/Free Full Text]
3. Demetrus A.J., Zerbe T., Banner B. Morphology of solid organ allograft arteriopathy: identification of proliferating intimal cell populations. Transplant Proc 1989;21:3667-3669.[Medline]
4. Billingham B.E. Histopathology of graft coronary disease. J Heart Lung Transplant 1992;12:538-544.
5. Reidy M.A. Biology of disease, a reassessment of endothelial injury and arterial lesion formation. Lab Invest 1985;53:513-520.[Medline]
6. Plissonnier D., Nochy D., Poncet P., Chantal M., Hinglais N., Bariety J., Michel J. Sequential immunological targeting of chronic experimental arterial allografts. Transplantation 1995;60(5):414-424.[Medline]
7. Alpiprantis A., Diex-Roux G., Mulder L., Zychlinsky A., Lang R. Do macrophages kill by apoptosis?. Immunol Today 1996;17:573-576.[Medline]
8. Schroter M., Lowin B., Borner C., Tschopp J. Regulation of Fas (Apo-1 /CD95)- and perforin mediated lytic pathways of primary cytotoxic T lymphocytes by the protooncogene bc1-2. Eur J Immunol 1995;25:3509-3513.[Medline]
9. Uren A.M., Vauz D. Molecular and clinical aspects of apoptosis. Pharmacol Ther 1996;72:37-50.[Medline]
10. Adarms D.H., Tilney N.L., Colins J.J., Karnovsky M.J. Experimental graft arteriosclerosis, I: the Lewis to F 344 allograft model. Transplantation 1992;53:1115-1119.[Medline]
11. Perlman H., Maiilard L., Krasinski K., Walsh K. Evidence for the rapid onset of apoptosis in medial smooth muscle cells after balloon injury. Circulation 1996;95(4):981-987.[Abstract/Free Full Text]
12. Gavrielli Y., Shermany Y., Ben Sasson S.A. Identification of programmed cell death in situ labeling of nuclear DNA fragmentation. J Cell Biol 1992;119(3):493-501.[Abstract/Free Full Text]
13. Fishman J.A., Ryan G.B., Karnovsky M.J. Endothelial regeneration in the rat carotid artery and the significance of endothelial denudation on the pathogenesis of myointimal thickening. Lab Invest 1975;32:339-351.[Medline]
14. Bergese S.D., Klenotic S.M., Wakely E.M., Sedmak D., Orosz G. Apoptosis in murine cardiac grafts. Transplantation 1997;63:320-325.[Medline]
15. Krams S.M., Egawa H., Quinn M.B., Villanueva J., Garcia-Kennedy R., Martinez O. Apoptosis as a mechanism of cell death in liver allograft rejection. Transplantation 1995;59:621-625.[Medline]
16. Zheng L., Fisher G., Miller R., Peschon J., Lynch D., Lenardo M. Induction of apoptosis in mature T cells by tumour necrosis factor. Nature 1995;377:348-351.[Medline]
17. Miura M., Friedlander R., Yung J. Tumor necrosis factor induced apoptosis is mediated by a CrmA-sensitive cell death pathway. Proc Natl Acad Sci USA 1995;92:8318-8322.[Abstract/Free Full Text]
18. Lowin B., Beerman F., Schmidt A., Tschopp J. A null mutation in the perforin gene abolishes cytolytic T lymphocyte and NK-mediated cytotoxicity. Proc Natl Acad Sci USA 1994;91:11571-11575.[Abstract/Free Full Text]
19. Zhivotovsky B., Burgess D.H., Orrenius S. Proteases in apoptosis. Experientia 1996;52:968-978.[Medline]
20. Hahn S., Gehri R., Erb P. Mechanism and biological significance of CD4-mediated cytotoxicity. Immunol Rev 1995;146:57-79.[Medline]

This article has been cited by other articles:

				J.-F. Legare, T. Issekutz, T. D. G. Lee, and G. Hirsch CD8+ T Lymphocytes Mediate Destruction of the Vascular Media in a Model of Chronic Rejection Am. J. Pathol., September 1, 2000; 157(3): 859 - 865. [Abstract] [Full Text] [PDF]

				M. Roque, J. T. Fallon, J. J. Badimon, W. X. Zhang, M. B. Taubman, and E. D. Reis Mouse Model of Femoral Artery Denudation Injury Associated With the Rapid Accumulation of Adhesion Molecules on the Luminal Surface and Recruitment of Neutrophils Arterioscler. Thromb. Vasc. Biol., February 1, 2000; 20(2): 335 - 342. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to Personal Folders Download to citation manager Permission Requests Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hirsch, G. M. Articles by Lee, T. Search for Related Content PubMed PubMed Citation Articles by Hirsch, G. M. Articles by Lee, T.